Vectors Used for the Expression of the H,K-ATPase α and β Subunits The cDNA coding for the rabbit H,K-ATPase α subunit () (GenBank accession no. ) was inserted into the multiple cloning site of the mammalian expression vector pcDNA 3.1(Zeo) (Invitrogen, Carlsbad, CA) containing the eukaryotic selection marker Zeocin ® (Invitrogen). Attachment Using Ajax Php Script there. The vector was then called pcDNA3.1(Zeo)-H,K-α. The cDNA coding for the rabbit H,K-ATPase β subunit () (GenBank accession no. ) was inserted into the multiple cloning site of the mammalian expression vector pcDNA 3 (G418) (Invitrogen) containing the eukaryotic selection marker G418 for neomycin resistance (pcDNA3(G418)-H,K-β). Site-directed Mutagenesis of Cys-321, Cys-813, Cys-822, and Cys-892 The mutation of Cys-813 to Thr, Cys-822 to Gly, and Cys-892 to Leu and the combination of these three residues were generated as reported previously ().

By using the QuickChange mutagenesis kit (Stratagene, La Jolla, CA), we additionally generated the mutation Cys-321 → Thr and Cys-321 → Ala. Keygen Php Maker Templates. For mutations Cys-321 → Thr/Ala, we used the sense primer GGCCATG TGCATTGGCTACACCTTCCTG and the antisense primer GTAGCCAATG CACATGGCCACTACAAAAAA. The mutations were achieved by exchanging the underlined bases TG → AC/GC (sense) and CA → GT/GC (antisense) coding now for threonine or alanine respectively. Literature And Composition Jago Pdf Printer.

All mutagenic cDNA sequences were excised using the EcoRI and MroI restriction enzymes and ligated in the corresponding sites of the cDNA of the rabbit H,K-ATPase α subunit in the pcDNA3.1(Zeo)-H,K-α vector. Each final construct was sequenced before use in transfection. Transfection of HEK293 Cells and Selection of Stable Cell Lines Human embryonic kidney cells (HEK293-ATCC CRL 1573) were transfected with pcDNA3-(G418)H,K-β as reported previously (), and a stable cell line was selected by adding at 60 h after transfection the eukaryotic selection marker G418 at a concentration of 0.75 μg of G418/ml of medium. This concentration of G418 was maintained until single colonies appeared. A colony was isolated, expanded, and grown in the presence of 0.25 μg of G418/ml of medium. The H,K-ATPase β subunit was stably expressed in this cell line, as confirmed by Western blot analysis using a monoclonal antibody against the H,K-ATPase β subunit, as described below.

Biochemical calculations – Irwin H. Segel, second edition, John Wiley & Sons, USA (1976). Introduction to Practical Biochemistry by Sawhney and Randhir Singh. BIOCHEMICAL CALCULATIONS SEGEL PDF PDF - Are you searching for Biochemical Calculations Segel Pdf Books? Now, you will be happy that at this time Biochemical. Steadystate Bagel IH Biochemical calculations New York Wiley 1976 441 p. Segel I H Enzyme kinetics behavior and analysis of rapid eBooks is available in digital format.

The H,K-ATPase β subunit-expressing cell line was then subjected to a second transfection with pcDNA3.1(Zeo)-H,K-α containing either wild type or mutant H,K-ATPase α subunit cDNAs. By adding the second eukaryotic selection marker Zeocin ® at a concentration of 0.4 mg/ml medium in addition to the maintenance concentration of G418 of 0.25 μg/ml medium, we were able to select stable cell lines expressing H,K-ATPase α as well as β subunits with good efficiency, as shown by Western blot analysis and confocal microscopy as described below.

For each mutation, several cell lines were selected and two clones with the best ratio of expressed H,K-ATPase to total protein were expanded for isolation of membranes. The maintenance concentration for Zeocin ® was 0.1 mg/ml medium. Preparation of Crude Membranes Cell layers from stable cell lines, grown to confluence, were washed with phosphate-buffered saline.

The cells were scraped and resuspended in buffer A (10 m m PIPES, 2 m m EGTA, 2 m m EDTA, pH 7.0). Buffer A was sodium-free. The cell suspension was homogenized with a tight Dounce homogenizer (Wheaton, Millville, NY). The homogenate was centrifuged at 800 × g for 5 min. The supernatant was collected, layered onto a 40% sucrose step gradient, and spun in a Beckman SW28 swinging bucket rotor at 25,000 rpm for 2.5 h at 4 °C. The fraction at the interface of sucrose/buffer was collected and diluted to a total volume of 15 ml in buffer A. The membrane fraction was collected by centrifugation in a Beckman 75Ti rotor (35,000 rpm, 4 °C, 30 min).

The pellet was resuspended in buffer A by homogenization with a 2-ml Teflon homogenizer (Wheaton). Game Counter Terrorism Di Hp Android. The total protein concentration was determined by the method of Bradford () with immune globulin G as a standard according to the manufacturer (Bio-Rad).

The typical protein concentration was ≈10 μg/μl. The membranes were aliquoted, flash-frozen, and stored in liquid nitrogen. SDS-Polyacrylamide Gel Electrophoresis and Western Blot Analysis Gel samples were prepared by mixing 1–5 μl of the above prepared membranes with 30 μl of gel sample buffer (4% SDS, 0.05% bromphenol blue (w/v), 20% glycerol, 1% β-mercaptoethanol (v/v) in 0.1 m Tris buffer pH 6.8). The samples were loaded on a 7% SDS-polyacrylamide gel.